DIR Return Create A Forum - Home
---------------------------------------------------------
nCoV_info
HTML https://ncovinfo.createaforum.com
---------------------------------------------------------
*****************************************************
DIR Return to: genetics
*****************************************************
#Post#: 310--------------------------------------------------
B.1.1.529 (=omicron)
By: gsgs Date: November 25, 2021, 10:20 pm
---------------------------------------------------------
HTML http://magictour.free.fr/zaf2i.GIF
HTML http://magictour.free.fr/hospgt.GIF
nicd-files :
HTML https://www.nicd.ac.za/wp-content/uploads/2021/12/
reports :
HTML https://www.nicd.ac.za/diseases-a-z-index/disease-index-covid-19/surveillance-reports/covid-19-special-reports/
daily hosp.:
HTML https://www.nicd.ac.za/diseases-a-z-index/disease-index-covid-19/surveillance-reports/daily-hospital-surveillance-datcov-report/
daily :
HTML https://www.nicd.ac.za/latest-confirmed-cases-of-covid-19-in-south-africa-5-december-2021/
HTML https://www.nicd.ac.za/diseases-a-z-index/disease-index-covid-19/surveillance-reports/national-covid-19-daily-report/
dashboard :
HTML https://gis.nicd.ac.za/portal/apps/opsdashboard/index.html#/15eb33988f104b73867606c1248578ff
HTML https://sacoronavirus.co.za/live-counter/
HTML https://www.timeslive.co.za/
HTML https://rekord.co.za
HTML https://www.citizen.co.za/
HTML https://www.businesslive.co.za/bd/
HTML https://www.sowetanlive.co.za/
HTML https://www.iol.co.za/the-star
--------------------------------------------
HTML https://twitter.com/miamalan/status/1463846528578109444
HTML https://twitter.com/Tuliodna
----------------------------------------------------------------
-------------------------------
weekly hospital admissions
S.Africa,599,554,536,628,1215,1802
Gauteng,132,127,143,303,821,1130 (1,71,201,827,1130)
----------------------------------------------------------------
--------------------------------
HTML https://www.dailymail.co.uk/news/article-10229159/South-Africa-new-red-travel-list-early-TOMORROW-fears-mutant-strain.html
'worst-ever' super-mutant Covid variant that will make vaccines
at least 40 per cent 'less effective'
South Africa, Namibia, Lesotho, Botswana, Eswatini and Zimbabwe
; emerged in Botswana
------------------------------------------
We estimate that 90% of the cases in Gauteng (at least 1000 a
day are this variant,
---------------------------------------------
A57V , del 69-70 , T95I , G142D , del 143-145 , N211I , L212V
, RE , V213P , R214E , G339D
S371L , S373P , S375F , K417N , N440K , G445S , S477N , T478K ,
E484K , Q493R
G496S , Q498R , N501Y , Y505H , T547K , D614G , H655Y , N679K ,
P681N , N784K
D796Y , N856K , Q954H , N969K , L981F
-------------------------------------------
[code]
spike:
A67V
del 69-70
T95I
G142D
del 143-145
N211I
L212V_RE
V213P
R214E
G339D
S371L
S373P
S375F
K417N
N440K
G446S
S477N
T478K
E484A
Q493R
G496S
Q498R
N501Y
Y505H
T547K
D614G
H655Y
N679K
P681H
N764K
D796Y
N856K
Q954H
N969K
L981F
E:T9I
M:D3G
M:Q19E
M:A63T
N:P13L
N:del 31-33
N:R203K
N:G204R
orf1ab :
PL:K38R
PL:L862LF
PL:V1069I
PL:del 1265
PL:L1266I
PL:A1892T
nsp4:T492I
3CL:P132H
nsp6:F34FL
nsp6:F35FILV
nsp6:del 105-107
nsp6:I189V
RdRP:P323L
nsp14:I42V
nsp15:F122FILV
[/code]
-------------------------------------------------------
available genomes up to 10 mutations apart.
available genomes up to 10 mutations apart.
“Omicron did not descend from previously identified "variant"
viruses and instead,
their closest evolutionary connection is to mid-2020 viruses”
writes @trvrb
The WHO has named it "omicron," and classified it as the worst
variant yet,
both in transmissibility and virulence.
---------------------------------------------------------
Dr. Angelique Coetzee, chair of the South African Medical
Association and a practising GP based in Pretoria, said it
was "premature" to make predictions of a health crisis.
"It's all speculation at this stage. It may be it's highly
transmissable but so far the cases we are seeing are
extremely mild," she said.
"Maybe two weeks from now I will have a different opinion
but this is what we are seeing. So are we seriously worried ?
No. We are concerned and we watch what's happening.
But for now we're saying "OK; there's a whole hype out there,
[We're] not sure why."
-------------------------------------------------
Belgium in an unvaccinated young adult woman who developed mild
flu-like symptoms 11 days after travelling to Egypt via Turkey.
-----------------------------------------------
HTML https://www.citizen.co.za/news/covid-19/2931496/new-covid-variant-more-transmissible/
Minister of Health Dr Joe Phahlaa
The NICD reported no unusual symptoms have been reported on
those infected with
the B.1.1.529 variant, and as with other variants, some people
infected with the variant
are asymptomatic as well.
HTML https://www.sowetanlive.co.za/news/south-africa/2021-11-26-covid-19-hospital-admissions-rise-in-gauteng-as-new-variant-rocks-sa/
HTML https://simple.wikipedia.org/wiki/COVID-19_pandemic_in_South_Africa
provincial health department of Gauteng gives daily numbers
of cases and hospitalisations
NICD : national infectious ...
HTML https://www.nicd.ac.za/latest-confirmed-cases-of-covid-19-in-south-africa-26-november-2021/
-------------------------------------------------
Nov 23
#COVID19 UPDATE: A total of 40,791 tests were conducted in the
last 24hrs,
with 868 new cases, which represents a 2.1% positivity rate. A
further 51#COVID19
related deaths have been reported, bringing total fatalities to
89,635 to date.
See more here:
HTML http://ow.ly/MZkr50GUFMc
Nov 22 The @nicd_sa
has observed an increase in the 7-day moving average for new
COVID-19 cases
and the percentage testing positive in Gauteng, particularly in
Tshwane
amongst 10 – 29 year old's over the past week. Read more here
Additionally, the NICD has recently identified a cluster amongst
the 20 – 44 age
group at an institute of higher education in Tshwane
--------------------------------------------------------
cases Oct24-Nov27 :
HTML http://magictour.free.fr/zaf2d.GIF
--------------------------------------------------
SA-doctor about omicron symptoms :
intense fatigue and a six-year-old child with a very high pulse
rate, she said.
None suffered from a loss of taste or smell.
mostly healthy men who turned up “feeling so tired”.
About half of them were unvaccinated.
her patients were all healthy and she was worried the new
variant
could still hit older people – with co-morbidities such as
diabetes
or heart disease – much harder.
------------------------------------------------------
only 30 hospital admissions yesterday !
HTML https://www.nicd.ac.za/latest-confirmed-cases-of-covid-19-in-south-africa-27-november-2021/
almost as last week, down from 58,98,60
----------------------------------------------------------------
----------
"We’re seeing a marked change in the demographic profile of
patients with COVID-19,”
Rudo Mathivha, head of the intensive care unit at Soweto’s
Baragwanath Hospital
Young people, in their 20s to just over their late 30s, are
coming in with moderate
to severe disease, some needing intensive care. About 65% are
not vaccinated and
most of the rest are only half-vaccinated,”
What looked like a cluster infection among some university
students in Pretoria
ballooned into hundreds of new cases and then thousands, first
in the capital city
and then to nearby Johannesburg,
----------------------------------------------------------------
--------
said Dr. Graham Snyder, medical director ...
Professor Andrew Pollard, the director of the Oxford Vaccine
Group, also said existing
vaccines should work against the new strain,
“It’s extremely unlikely that a reboot of a pandemic in a
vaccinated population
like we saw last year (with the Delta variant) is going to
happen,” he told BBC radio.
The National Coronavirus Command Council (NCCC) met Saturday to
discuss
possible measures, while weighing the impact any moves will have
on the
economy, said the people, who asked not to be identified because
the talks aren’t public.
HTML https://en.wikipedia.org/wiki/List_of_newspapers_in_South_Africa
HTML https://www.sowetanlive.co.za/
HTML https://www.iol.co.za/the-star
HTML https://www.timeslive.co.za/
HTML https://www.timeslive.co.za/news/south-africa/2021-11-27-young-people-bearing-brunt-of-covid-19-resurgence-icu-doctor-warns/
HTML https://www.citizen.co.za/
HTML https://www.citizen.co.za/news/covid-19/2931662/astrazeneca-jab-scientist-says-vaccines-should-work-against-omicron/
HTML https://www.businesslive.co.za/bd/
40% of vaccinated Malaysians received Sinovac, which has much
higher breakthrough
infection risk than Pfizer and AZ.
The two positive #Omicron cases were asymptomatic and fully
vaccinated.
They were amongst fourteen people from southern Africa who
arrived on Qatar
Airways flight QR908, Doha to Sydney,
Four (4) cases of the new variant, omicron, and all were fully
vaccinated.
Boris Johnson says omicron can spread rapidly and affect those
who are double vaccinated
South Africa's health minister says on Nov26 , based on a small
sample of Omicron cases,
the majority of hospital patients are unvaccinated: "It
indicates that the vaccines are
providing protection"
Currently there are around 1.000 confirmed/suspected Omicron
cases.
COVID has a hospitalization rate of around 4%, CFR of around
0.8% in some countries.
Drosten geht davon aus, dass Impfstoffe auch gegen omicron
schützen.
noch nicht sicher nachgewiesen, dass die neue Variante auch
ansteckender ist.
keine Hinweise darauf, dass das Virus schwerere
Krankheitsverläufe auslösen kann
Unterbinden von Flugverbindungen ... gerechtfertigt
Klaus Stöhr hält Reisebeschränkungen für sinnlos und beruhigt:
Die Impfstoffe wirkten auch gegen mutierte Coronaviren.
--------------------------------------
Most were men aged under 40. Just under half were vaccinated.
They also had mild muscle aches, a “scratchy throat” and dry
cough, she said.
Only a few had a slightly high temperature.
These very mild symptoms were different to other variants,
which gave more severe symptoms.
Coetzee alerted health officials of a “clinical picture that
doesn’t fit Delta”
on November 18, when she received the first seven of her 30-odd
patients.
-----------------------------------
Coetzee - video :
HTML https://www.thegatewaypundit.com/2021/11/update-south-african-doctor-discovered-omitron-variant-says-nothing-worry-mild-symptoms-video/?utm_source=Twitter&utm_medium=PostTopSharingButtons&utm_campaign=websitesharingbuttons
Moderna chief medical officer Paul Burton said he suspects the
new Omicron
coronavirus variant may elude current vaccines, and if so, a
reformulated shot
could be available early in 2022.
-------------------------------------------------------
No new Covid-19 restrictions will be imposed but the government
has set up
a task team to explore the possibility of mandatory vaccines,
South African President Cyril Ramaphosa said on Sunday.
2021-11-28
The country will remain on coronavirus alert level 1 for now.
[because of vaccines]
The ministerial advisory committee has suggested booster doses
for the older
population and those with immunodeficiencies, on the
recommendation of doctors.
Ramaphosa said both a fourth wave and new variants were expected
by scientists.
-------------------------------------------------------
health minister Phaahia calls for vaccinations, but no
mentioning of evidence that
the vaccine still works
------------------------------------------------------------
Großbritannien hat wegen der sich ausbreitenden Omikron-Variante
des Coronavirus
ein außerplanmäßiges Treffen der G7-Gesundheitsminister
einberufen.
Es findert nach Angaben der Regierung in London bereits heute
statt.
-------------------------------------------------
Barry Schoub, the head of South Africa’s Ministerial Advisory
Committee of SA..
@sailorrooscout
“I think what we can be pretty comfortable… that the vaccine
will still prevent serious disease,” he said. “That I think we
are pretty sure about. How effective it will be in preventing
milder disease —
that we’ve still got to understand.”
HTML https://timesofisrael.com/s-african-expe
HTML https://www.timesofisrael.com/s-african-expert-downplays-threat-from-omicron-we-wont-have-a-severe-epidemic/
-------------------------------------------------------
On FTN, @ScottGottliebMD says: "If you talk to people in vaccine
circles, people who are
working on a vaccine, they have a pretty good degree of
confidence that a boosted
vaccine — so, three full doses of vaccine — is going to be
fairly protective against
this new variant."
----------------------------------------------------------------
-
The "vast majority" of Covid-19 patients recently admitted to
hospital were unvaccinated,
and most were younger adults
---------------------------------------------------------
private general practitioner (GP) Dr Unben Pillay told a
department of health virtual media
briefing that in the past 10 days, GPs started seeing “a sharp
increase in cases of patients
presenting with flu-like symptoms: dry cough, fever, night sweat
and general body pains”.
----------------------------------------------------------------
----------
WHO also weighed in on effectiveness of earlier infection
against Omicron, noting that
early evidence suggests an increased risk of reinfection.
----------------------------------------------------------------
------
the WHO said corticosteroids and IL6 receptor blockers are still
effective for treating
patients with severe COVID-19,
----------------------------------------------------------------
---------------------------------
#Post#: 311--------------------------------------------------
Re: B.1.1.529 (=omicron)
By: gsgs Date: November 29, 2021, 10:59 pm
---------------------------------------------------------
That same day, a 36-year-old man left South Africa for Hong
Kong, a city with some of the strictest quarantine rules on
earth. On Nov. 13, while staying in a designated quarantine
hotel, he took a test that confirmed him as one of the earliest
cases of Omicron.
Five days later, a 62-year old man staying in the room across
the corridor also tested positive. He, too, had the variant, and
the genomes of the two samples were so close that one had
clearly caught the virus from the other, said Yuen Kwok-yung, an
infectious diseases professor at the University of Hong Kong who
advises the city’s government on their pandemic response.
CCTV monitors, however, showed that the two men had never met,
nor opened their doors at the same time, nor shared any items,
and had only contacted hotel personnel in full protective gear,
said Prof. Yuen. Most likely, air from one of their hotel rooms
spread into the hallway and through a door opening, where the
other breathed it in, said Prof. Yuen, who inspected the site
using a smoke test.
#Post#: 312--------------------------------------------------
Re: B.1.1.529 (=omicron)
By: gsgs Date: November 30, 2021, 12:12 am
---------------------------------------------------------
flutrackers-thread:
HTML https://flutrackers.com/forum/forum/the-pandemic-discussion-forum/928700-omicron-covid-19-variant-b-1-1529-a-variant-of-concern/page2
----------------------------------------------------------------
Gauteng:
weekly hosp : 125,120,135,276,580,71(incomplete)
weekly cases : 593,547,426,737,2762
weekly pos.rates 0.9%,0.9%,0.7%,1.1%,4.3%
9,8,7,3,1,1,1,1,1,0 promille increase yesterday in hosp by
age10group
{doesn't look milder than delta from these numbers}
----------------------------------------------------------------
--------------------------
> Israel is now reporting community transmission of Omicron
from a cardiologist
> with 3 doses to another cardiologist with 3 doses Warning
sign
--------------------------------------------------------------
2021-11-30 : 5 omicron sequences at cog-UK
[code]
B.1.1.529 w=9
ENG/MILK-2B987AD/2021,Y,2021-11-22,100,
B.1.1.529,PLEARN-v1.2.97,0.0,0.9925692411619005, Omicron
(B.1.1.529-like),0.851100,0.000000,X,X,T,A,H,del,Q,L,
orf1ab:K856R, synSNP:C3037T, synSNP:T5386G, synSNP:G5515T,
orf1ab:A2710T, orf1ab:T3255I, orf1ab:P3395H,
orf1ab:I3758V,synSNP:T13195C, orf1ab:P4715L,synSNP:C15240T,
orf1ab:I5967V, S:A67V, S:T95I, S:G339D,
S:S371L, S:S373P, S:S375F, S:S477N,
S:T478K, S:E484A, S:Q493R, S:G496S,
S:Q498R, S:N501Y, S:Y505H, S:T547K,
S:D614G, S:H655Y, S:N679K, S:P681H,
S:N764K, S:D796Y, S:N856K, S:Q954H,
S:N969K, S:L981F,synSNP:C25000T,synSNP:C25584T,
E:T9I, M:D3G, M:Q19E,
M:A63T,synSNP:A27259C, N:P13L, N:R203K,
N:G204R, Y, G, A,
ref, _
ENG/MILK-2B95A89/2021,Y,2021-11-22,100,
B.1.1.529,PLEARN-v1.2.97,0.0,0.9964109466128309, Omicron
(B.1.1.529-like),0.936200,0.000000,X,X,T,A,H,del,Q,L,
orf1ab:K856R, synSNP:C3037T, synSNP:T5386G, orf1ab:T1822I,
orf1ab:A2710T, orf1ab:T3255I, orf1ab:P3395H,
orf1ab:I3758V,synSNP:T13195C, orf1ab:P4715L,synSNP:C15240T,
orf1ab:I5967V, S:A67V, S:T95I, S:G339D,
S:S371L, S:S373P, S:S375F, S:K417N,
S:S477N, S:T478K, S:E484A, S:Q493R,
S:G496S, S:Q498R, S:N501Y, S:Y505H,
S:T547K, S:D614G, S:H655Y, S:N679K,
S:P681H, S:N764K, S:D796Y, S:N856K,
S:Q954H, S:N969K,
S:L981F,synSNP:C25000T,synSNP:C25584T, E:T9I,
M:D3G, M:Q19E, M:A63T,synSNP:A27259C,
N:P13L, N:R203K, N:G204R, Y,
G, A, ref, _
ENG/ALDP-2B4DF63/2021,Y,2021-11-20, 99,
B.1.1.529,PLEARN-v1.2.97,0.0,0.9925692411619005, Omicron
(B.1.1.529-like),0.851100,0.000000,X,X,T,A,H,del,Q,L,
orf1ab:K856R, synSNP:C3037T, synSNP:T5386G, orf1ab:V1887I,
orf1ab:A2710T, orf1ab:T3255I, orf1ab:P3395H,
orf1ab:I3758V,synSNP:T13195C, orf1ab:P4715L,synSNP:C15240T,
orf1ab:F5086Y, orf1ab:I5967V, S:A67V, S:T95I,
S:G339D, S:S371L, S:S373P, S:S375F,
S:S477N, S:T478K, S:E484A, S:Q493R,
S:G496S, S:Q498R, S:N501Y, S:Y505H,
S:T547K, S:D614G, S:H655Y, S:N679K,
S:P681H, S:N764K, S:D796Y, S:N856K,
S:Q954H, S:N969K,
S:L981F,synSNP:C25000T,synSNP:C25584T, E:T9I,
M:D3G, M:Q19E, M:A63T,synSNP:A27259C,
N:P13L, N:R203K, N:G204R, Y,
G, A, ref, _
ENG/MILK-2B67570/2021,Y,2021-11-21,100,
B.1.1.529,PLEARN-v1.2.97,0.0,0.9925692411619005, Omicron
(B.1.1.529-like),0.851100,0.000000,X,X,T,A,H,del,Q,L,
orf1ab:K856R, synSNP:C3037T, synSNP:T5386G, orf1ab:V1887I,
orf1ab:A2710T, orf1ab:T3255I, orf1ab:P3395H,
orf1ab:I3758V,synSNP:T13195C, orf1ab:P4715L,synSNP:C15240T,
orf1ab:I5967V, S:A67V, S:T95I, S:G339D,
S:S371L, S:S373P, S:S375F, S:S477N,
S:T478K, S:E484A, S:Q493R, S:G496S,
S:Q498R, S:N501Y, S:Y505H, S:T547K,
S:D614G, S:H655Y, S:N679K, S:P681H,
S:N764K, S:D796Y, S:N856K, S:Q954H,
S:N969K, S:L981F,synSNP:C25000T,synSNP:C25584T,
E:T9I, M:D3G, M:Q19E,
M:A63T,synSNP:A27259C, N:P13L, N:R203K,
N:G204R, Y, G, A,
ref, _
ENG/PHEC-3U06FU0A/2021,N,2021-11-23,100,
B.1.1.529,PLEARN-v1.2.97,0.0,0.9247776976688296, Omicron
(B.1.1.529-like),0.680900,0.000000,X,X,T,X,H,del,X,L,
orf1ab:K856R, synSNP:C3037T, synSNP:T5386G, orf1ab:A2710T,
orf1ab:T3255I, orf1ab:P3395H, orf1ab:I3758V,synSNP:T13195C,
orf1ab:P4715L,synSNP:C15240T, orf1ab:I5967V, S:A67V,
S:T95I, S:G339D, S:T547K, S:D614G,
S:H655Y, S:N679K, S:P681H, S:N764K,
S:D796Y, S:N856K, S:Q954H, S:N969K,
S:L981F,synSNP:C25000T,synSNP:C25584T, E:T9I,
M:Q19E, M:A63T,synSNP:A27259C, N:P13L,
N:R203K, N:G204R, X, G,
X, ref,
[/code]
[code]
1 2 3 4 5 6
--------------------------------------------------
1 >Wuhan-Hu1 0 54 60 54 38 59
2 >England/MILK-2B987AD/202 54 0 9 4 3 10
3 >England/MILK-2B95A89/202 60 9 0 9 8 5
4 >England/MILK-2B67570/202 54 4 9 0 3 6
5 >England/PHEC-3U06FU0A/202 38 3 8 3 0 8
6 >England/ALDP-2B4DF63/202 59 10 5 6 8 0
---------------------------------------------------
1 2 3 4 5 6
0000000000111111111111112222222222222222222222222222222222222222
0233555588001344558999991122222233333333333333344445566667788888
2808357938045145251222227856666800000000245668914450525572823888
4337813293243905426011116488889200245678113016533710973816182999
1277650435997582013902472672385214297424124833793829399688600012
-codon-position---------- 1111 22 2122 21 1 22 2 2 1 2 22
21 1211121 21 1 2 12
Index--------------------CACTTGCGGTCCATCTCTATAAACCCGTCTCGGCAAGAA
TCACTCCGCATCCCCACGACACGGG
1 >Wuhan-Hu1
................................................................
2 >ENG/MILK-2B987AD/202
TGTKGT..A.TAGCT.TWG.....TTACTCT-AACGAGTCAGTGAATATATTTTGGACTTTAAC
4 >ENG/MILK-2B67570/202
TGT.G..AAYTAGCT.TWG.....TTACTCT-AACGAGTCAGTGAATATATTTTGGACTTTAAC
5 >ENG/PHEC-3U06FU0A/202
TGT.G...A.TAGCT.T.G.....TTA-------------AGTGAATATATTTT-GACTTTAAC
3 >ENG/MILK-2B95A89/202
TGT.G.T.A.TAGCTYTWGKRRRMTTACTCTTAACGAGTCAGTGAATATATTTTGGACTTTAAC
6 >ENG/ALDP-2B4DF63/202
TGT.G..AAYTAGCT.TAGKRRRMTTACTCT-AACGAGTCAGTGAATATATTTTGGACTTTAAC
Index--------------------CACTTGCGGTCCATCTCTATAAACCCGTCTCGGCAAGAA
TCACTCCGCATCCCCACGACACGGG
-codon-position----------1 1111 22 2122 21 1 22 2 2 1 2
22 21 1211121 21 1 2 12
0000000000111111111111112222222222222222222222222222222222222222
0233555588001344558999991122222233333333333333344445566667788888
2808357938045145251222227856666800000000245668914450525572823888
4337813293243905426011116488889200245678113016533710973816182999
1277650435997582013902472672385214297424124833793829399688600012
[/code]
@TWenseleers
But to explain the current growth rate advantage of Omicron over
Delta one already
has to assume almost complete immune evasion even if one assumes
an R0 that is
the same as Delta. R0 can't be much less than that of Delta then
I would say...
---------------------------------------------------------------
cluster at TUT Nov.18
HTML https://rekord.co.za/399202/concerns-over-rising-covid-19-cases-in-tshwane/
----------------------------------------------------------------
---
Head of EU Public Health gives information that thus far
*ALL* (42) Omicron cases in EU are either mild or without
symptoms.
----------------------------------------------------------------
On Monday, an NICD presentation a flagged a large number of
COVID-19
admissions among infants aged under two years as an area of
concern.
But von Gottberg cautioned against linking that with Omicron
just yet.
"It looks like in fact some of those admissions might have
started before
the emergence of Omicron. We are also seeing that there was an
increase
in influenza cases just in the last month or so, and so we need
to be really
careful to look at the other respiratory infections," she said.
----------------------------------------------------
... a report by Channel 12 said the Pfizer vaccine is just
slightly less effective in
preventing infection with Omicron than with Delta – 90% as
opposed to 95% –
while it is as effective – around 93% – in preventing serious
symptoms at least
for those vaccinated with a booster.
According to the report, the ability of the variant to infect is
higher than Delta but
not as much as feared – around 1.3 times higher...
----------------------------------------------------------------
-
Minimum dose interval for booster jabs to be halved from 6
months to 3
months and all adults to be offered booster Covid vaccine,
UK Health Secretary Sajid Javid confirms
-----------------------------------------------------
@jburnmurdoch
So far admissions following ~same path as past waves.
------------------------------------------------------------
The earliest known cases are still from southern Africa. The
first identified samples were
collected Nov. 9, from a 34-year-old man and a 23-year-old man
in Johannesburg,
according to the GISAID global database. On Nov. 11, five
samples of the variant were
collected in Botswana.
-----------------------------------------------------------
#Post#: 313--------------------------------------------------
Re: B.1.1.529 (=omicron)
By: gsgs Date: December 1, 2021, 4:48 am
---------------------------------------------------------
2021-12-01
----------------------------------------------------------------
-------
Botswana : 15 more cases (+4=19)
14 in the Greater Gaborone DHMT area,
4 in the Serowe/Palapye DHMT area, Truck drivers
1 in Kgatleng DHMT from ZA
3 mild , 12 none 11 vaxed 4 not (asym)
----------------------------------------------------------------
----
map of the initial omicron-wave in ZA :
HTML http://magictour.free.fr/o-1201.GIF
----------------------------------------------------------------
--------------
On Omicron, for people with prior Covid but unvaccinated:
“In our population…where many people have had previous
infection,
we believe that that previous infection doesn’t provide them
with
protection from infection due to Omicron”
----------------------------------------------------------------
--
HTML https://www.centerforhealthsecurity.org/our-work/publications/to-stop-a-pandemic--a-better-approach-to-global-health-security
To Stop a Pandemic - A Better Approach to Global Health Security
cited by 5 :
HTML https://scholar.google.de/scholar?cites=12966832627588286534&as_sdt=2005&sciodt=0,5&hl=de
----------------------------------------------------------------
-------
what was that organisation, created last year, dedicated to find
and stop new outbreaks like omicron ?
Head was Ian Lipkin, I remember how I applauded at twitter. But
now I can't find it.
Only nichtssagende stetments by Lipkin now, no reference to that
task.
We were asking for it here since 2006's H5N1
China stopped Wuhan-Hu-1 in Feb.2020
But they let it escape to other countries
and most of the rest of the world didn't stop it
Alpha, Delta were detected too late.
Omicron was detected early but spreads better and faster, but i
think we should try to stop it to contain it now.,
support ZA's measures financially. Although it's probably invain
and too late.
HTML https://www.chinadaily.com.cn/a/202103/10/WS604819fda31024ad0baae175.html
The key to global public health is global cooperation,
transparency and investment."
the lack of international, inter-institutional and interpersonal
trust, respect and collaboration,
[not the project that I had in mind. It was rather about early
stopping emerging pandemics]
----------------------------------------------------------------
--------
HTML https://twitter.com/PPI_Insights
----------------------------------------------------------------
----------
Epidemiological data from South Africa shows a 3-fold increase
in risk for reinfection
due to Omicron vs. Beta and Delta.
----------------------------------------------------------------
--------
Eine Überstandene Corona-Infektion schützt laut WHO offenbar
nicht vor Omikron-Variante
SUBSTANTIAL population-level evidence for evasion of immunity
from prior infection
HTML https://www.medrxiv.org/content/10.1101/2021.11.11.21266068v2
----------------------------------------------------------------
--
67 omicrons at cog-uk on 1202
---------------------------------------------------------
#Post#: 314--------------------------------------------------
Re: B.1.1.529 (=omicron)
By: gsgs Date: December 3, 2021, 10:40 pm
---------------------------------------------------------
2021-12-04
BioNTech-Chef sieht Notwendigkeit Impfstoff-Anpassung
-------------------------------------
Risk Assessment for Omicron has been published.
Everything is still uncertain, but it doesn't look good.
HTML https://twitter.com/Dr_D_Robertson/status/1466807346487869445/photo/1
---------------------------------------
first time we've seen data on vaccination status of hospitalised
covid patients in Gauteng
vaccination status of in-hospital patients (n=1351) public and
private
total:1121+230
unknown : 814 ; 190
no : 286 ; 31
yes : 21 ; 9
general wards ; ICU/HC
VE(hosp)=86% , VE(ICU)=46%(low numbers)
----------------------------------------------------------------
----
In France the numbers have been inverting for a few months now
(then again,
it's winter now over here)
Some regions show up to 76% vaccinated in ICU, despite 94%
vaccination status (12+yo)
----------------------------------------------------------------
---
What the CDC in Europe reported today is 50% of the cases
they've seen outside
South Africa have been asymptomatic, 50% have just presented
with mild symptoms,"
says @ScottGottliebMD on Omicron. "The vaccines--seem to be
protective against more severe disease."
---------------------------------------------------------------
HTML https://twitter.com/jburnmurdoch/status/1467270450111787012
------------------------------------------------------
2021-12-06, 183 confirmed omicron-cases in Denmark
-----------------------------------------------------
J.Ward estimates the impact of omicron :
HTML https://twitter.com/JamesWard73/status/1467631048267866117
--------------------------------------------------------
Data from @nicd_sa
show that in Gauteng province, the share of Covid-positive
patients in ICU or on
ventilators is somewhere between 2-3x lower than it was at the
same stage of
the Delta wave
------------------------------------------------------
In southern New England, it turns out that ~27% of vaccines
were given to
previously infected individuals. Pre-print below. 1/
HTML https://medrxiv.org/content/10.110
#Post#: 315--------------------------------------------------
Re: B.1.1.529 (=omicron)
By: gsgs Date: December 7, 2021, 10:48 pm
---------------------------------------------------------
HTML https://drive.google.com/file/d/1bBO3DLrvVMYYMDg5CKUBVaunyKvOVfhv/view
Alex Sigal @sigallab 7h
There are a few results:
1. Omicron still uses ACE2
2. There is a very large drop in neutralization of Omicron by
BNT162b2 (2 doses) immunity
relative to ancestral virus
3. Omicron escape from BNT162b2 neutralization is incomplete.
Previous infection + vaccination still neutralizes
------------------------------------
this was better than I expected of Omicron.
-----------------------------
Chise
Reduction in nAbs was even LESS in those who had a previous
infection & two
doses of Pfizer’s vaccine. Boosters should be able to take this
on!
------------------------------------
right thing to do to switch vaccine between prime and boost
=====================================
@BenjMurrell
HTML https://drive.google.com/file/d/1CuxmNYj5cpIuxWXhjjVmuDqntxXwlfXQ/view
Omicron antibody neutralization thread, with preliminary
results, and substantial caveats.
our first results were read this afternoon (1/n).
=====================================================
@CiesekSandra 2021-12-08,06:20UTC
2x Biontech, 2x Moderna, 1xAZ/1x Biontech nach 6 Monaten 0%
Neutralisation bei Omicron,
auch 3x Biontech 3 Monate nach Booster nur 25% NT versus 95% bei
Delta.
Bis zu 37fache Reduktion Delta vs. Omicron
HTML https://twitter.com/CiesekSandra/status/1468465347519041539/photo/1
Die monoklonalen AK imdevimab und casirivimab sind - wie
erwartet- bei Omicron wirkungslos
#Post#: 316--------------------------------------------------
Re: B.1.1.529 (=omicron)
By: gsgs Date: December 8, 2021, 9:21 pm
---------------------------------------------------------
HTML https://www.capetalk.co.za/articles/434212/2-weeks-of-omicron-it-looks-like-people-don-t-get-as-sick-as-with-delta
3/4 of Covid patients were in the hospital for other conditions,
and only found out they
had Covid-19 upon arrival.
Hospital stays seem considerably shorter (2.8 days, on average)
than during
the pre-Omicron pandemic (8.5 days, on average).
----------------------------------------------------------------
--
HTML https://www.citizen.co.za/news/vaccine-info/2937972/majority-of-tshwane-patients-unvaccinated/
24/38 adults in the Covid wards on 2 December, 24 were
unvaccinated,
eight had unknown vaccination status and only six had had the
jabs.
8/9 of hospitalised for Covid pneumonia, were unvaccinated
80% of admissions were below the age of 50.
----------------------------------------------------------------
-----
@K_G_Andersen
I think it's likely VE against hospitalization will be
relatively well-preserved (~50%?)
with 2x vax, increasing to >75% with boost.
I don't expect much VE to be preserved against infection.
----------------------------------------------------------------
--------------
sister lineage , BA.1 , BA.2
HTML https://github.com/cov-lineages/pango-designation/issues/361
HTML https://user-images.githubusercontent.com/686405/145027666-318a51b4-0053-4150-a2fc-783752442ae3.png
#Post#: 317--------------------------------------------------
Re: B.1.1.529 (=omicron)
By: gsgs Date: December 9, 2021, 9:23 pm
---------------------------------------------------------
"in the South African city of Tshwane, 70% of those aged 50-69
and 90% of over-80s
had severe cases during the Delta wave. This share is now around
30% for all ages."
----------------------------------------------------------------
------
2021-12-09 , Alarm as almost 20% of South Africa’s healthcare
workers contract Covid
Richard Lessels,
Victor Khanyile, the deputy director of human resources at the
department of health,
said there were 72 678 public sector healthcare workers
infected as of 6 December,
representing 18% of the entire public healthcare workforce —
403 443 clinical and support staff.
Gauteng, at 17 008, has the highest number of healthcare
workers infected followed by
the Eastern Cape with 11 975 and KwaZulu-Natal with
11 246.
shorter-lived than previous variants
HTML https://mg.co.za/coronavirus-essentials/2021-12-09-alarm-as-almost-20-of-south-africas-healthcare-workers-contract-covid/
----------------------------------------------------------------
----
update week 48 , comparing hospital surveillance in Tshwane
waves 2,3,4
HTML https://www.nicd.ac.za/wp-content/uploads/2021/12/COVID-19-HOSPITAL-SURVEILLANCE-UPDATE_WEEK-48-2021_rev.pdf
HTML http://magictour.free.fr/tshh48.GIF
----------------------------------------------------------------
-
Selbst Booster scheinen keinen Schutz (oder nur geringen) vor
Infektion und leichtem Verlauf zu bieten.
43% with dyspnaea (shortness of breath) despite 3 shots
--------------------------------------------------------
18/1280=1.4% of Omicron cases in Denmark are hospitalized. Delta
was 2%
-------------------------------------------------------
2021-12-11 : 30% of (COVID)-infections in London are omicron
----------------------------------------------------
VE(symp,2AZ,omicron,5m?,UK)=0
VE(symp,2BNT,omicron,5m?,UK)~30%
VE(symp,3BNT,omicron,1m,UK)=72%
HTML https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/1040076/Technical_Briefing_31.pdf
HTML https://twitter.com/kallmemeg/status/1469351833416122369
-----------------------------------------------------------
HTML https://twitter.com/BallouxFrancois/status/1469733674426023936
also thread by Tom Moultre
-------------------------------------------------------
backlog now, the decrease was not real
----------------------------------------------------------------
------------
Current earliest detection of omicron in South Africa: 8
November, Gauteng
----------------------------------------------------------------
--------------
South African president tests positive for Covid-19
----------------------------------------------------------------
--
HTML https://www.dailymail.co.uk/news/article-10299773/South-Africas-Omicron-outbreak-slows-figures-suggest.html
----------------------------------------------------------------
----
VE(2xBNT,omicron,hosp)=70%
VE(2xBNT,omicron,inf)=33%
wanes
1. 2-4 wks after 2nd dose: 56%
2. 3-4 mnths after 2nd dose: 25%
VE(delta-->omicron,inf)=60%
Adults (18+) infected with #Omicron = 29% less likely to be
hospitalised (than with Wuhuan-Hu1)
HTML https://twitter.com/miamalan/status/1470684351151157252
----------------------------------------------------------------
--
VE(3*BNT,omicron,symp)=75%
----------------------------------------------------------------
-
CDC; Omicron = 2.9% of cases in USA in week 49 , CDC; 13% in
NY,NJ
----------------------------------------------------------------
---
SinoVac doesn’t provide sufficient antibodies to neutralize
omicron
----------------------------------------------------------------
-------
HKUMed shows Omicron infects and multiplies 70X faster than
Delta in the
human bronchus, which may explain why it transmits faster, BUT
also shows
Omicron infection in the lung is significantly LOWER than the
original virus,
which may be an indicator of lower disease severity.
----------------------------------------------------------------
-
#Post#: 318--------------------------------------------------
Re: B.1.1.529 (=omicron)
By: gsgs Date: December 18, 2021, 11:23 pm
---------------------------------------------------------
==============================
SA , netcare-CEO , 12-13 : it's mild
------------------------------------------
neue Studie Imperial College, von Lauterbach vor 14h zitiert ,
als wahrscheinlich eingestuft
"Omnikron tellt alles in den Schatten, was wir bisher in
Pandemie gesehen haben"
Katastrophenfall in London ausgerufen
hard lockdown in Netherlands at 2021-12-19, 5 AM
Denmark hospitalisations remain low
Lauterbach schliesst Lockdown ueber Weihnachten aus
Bund und Länder beraten am Dienstag (2021-12-21) über omicron
2021-12-20 , Ireland strengthens lockdown
Denmark re-introduces restrictions
Sachsen verschaeft Corona Massnahmen
----------------------------
in Thueringen ab 2021-12-20
Sobald eine ungeimpfte Person an einem Treffen teilnimmt,
dürfen nur noch zwei Personen aus einem weiteren Haushalt dabei
sein.
Bisher galt diese Regel nicht für Geimpfte und Genesene.
--------------------------------
Der neue Expertenrat der Bundesregierung spricht sich für
Kontaktbeschränkungen "bereits für
die kommenden Tage" aus. Es gehe um "wirksame bundesweit
abgestimmte Gegenmaßnahmen",
heißt es in der Stellungnahme, die dem ARD-Hauptstadtstudio
vorliegt
Einschätzung der Wissenschaftler
Bisher sei nicht davon auszugehen, dass im Vergleich zur
Delta-Variante Menschen
ohne Immunschutz einen milderen Krankheitsverlauf hätten
-------------------------------
It is obvious we are far from 95 per cent effectiveness that we
obtained against the initial virus,"
Ugur Sahin told on 2021-12-20
VE(omicron,2BNT,hosp)=70%
-----------------------------------------------
Zoe : Runny nose, Headache , Fatigue , Sneezing , Sore
throat
----------------------------------------------------------------
--
HALF of patients in London hospitals 'with Covid' were only
diagnosed AFTER arriving
HTML with another ailment https://trib.
----------------------------------------------------------------
-------------
HTML https://metro.co.uk/2021/12/16/omicron-may-be-milder-but-we-should-all-listen-to-chris-whitty-15782431/
Chris Whitty : "slightly milder than delta"
Omicron may be ‘intrinsically milder’, but there is still not
yet ‘clear evidence’.
--------------------------------------------
HTML https://datakingz.com/2021/12/22/london-playbook-scoop-omicron-milder-in-uk-new-years-fireworks-liz-vs-no-10/
SCOOP: The Omicron coronavirus variant is causing a milder
disease than the Delta
strain in most Britons, U.K. government scientists are set to
conclude. The U.K.
Health Security Agency is due to publish its early real-world
data on the severity
of the disease before Christmas, and Playbook is told the
experts are likely to offer
a mixed outlook, with some positives and some negatives
---------------------------------------------
risk of hospitalisation from omicron is 1/3 of the delta risk
HTML https://www.research.ed.ac.uk/en/pub...effectiveness-
-------------------------------------------
new data from @IHME_UW predict nearly 3 billion COVID-19
infections globally
in the next 2 months
----------------------------------------
#Post#: 319--------------------------------------------------
Re: B.1.1.529 (=omicron)
By: gsgs Date: December 23, 2021, 5:35 am
---------------------------------------------------------
early omicron severety studies :
ZAF :
HTML https://t.co/g24KTGU7Io
DNK :
HTML https://t.co/pQnetTf7IP
ENG :
HTML https://t.co/chqPEhph3p
SCO :
HTML https://t.co/CMv2zkG2sh
DNK,VE :
HTML https://www.medrxiv.org/content/10.1101/2021.12.20.21267966v2.full.pdf
----------------------------------------------------------------
---------
vaccine effectiveness
AZ,BNT,Mod
D,2,h,78,91
D,3,h,98,98
O,2,h,51,75
O,3,h,90,86
O,2,h,ar,54,77
O,3,h,ar,92,88
O,2,s,--,55,37
ar:adjusted for reinfections
s: symptomatic disease
h:hospitalisation
O:omicron
D:delta
w:weeks
HTML https://twitter.com/freja_kirsebom/status/1474070653326270473
O,2AZ+BNT,s,3w,60
O,2AZ+BNT,s,10w,35
O,2AZ+Mod,s,10w,45
O,3BNT,s,1w,70
O,3BNT,s,10w,45
O,2BNT+Mod,9w,72
O,2Mod,3w,50
O,2Mod,22w,0
----------------------------------------------------------------
---------
=============================================
SARS CoV-2 entry into a cell can occur via two routes: one that
only needs ACE2 and
another that needs ACE2 and TMPRSS2.
TMPRSS2 (T2) is higher in the lower airways and so virus goes
the second route in those areas.
Omicron spike has reduced ability to use the ACE2+T2 route and
doesn't respond to higher
T2 levels, unlike Delta
==========================================================
TB33 : risk(EC or hosp,omicron)=0.62*risk(EC,delta)
risk(hosp,omicron)=0.38*risk(hosp,delta)
This effect is still present when stratified by vaccination
status
Using a very similar data set, Imperial College, provided
estimates that Omicron cases had a 15
to 25% (Hazard ratio 0.8; 95% CI 0.75-85) reduced risk of
emergency department attendance
(hospitalisations in their data set) and 40 to 49% (HR 0.55, 95%
CI 0.51-59) reduced risk of a
hospitalisation with a stay of one or more nights. Importantly,
this group attempt to impute the
effect of prior infection, highlighting that while 17% of the
population have tested positive for
COVID-19, this is likely to capture only one-third of total
infections that have occurred in
England. Including the likelihood of previous infection, in
addition to vaccination in their model,
they have estimated the intrinsic risk difference between Delta
and Omicron as between 0 to
30% and the reduced risk of hospitalisation in those previously
infected estimated as 55 to 70%.
===========================================================
The Sato Lab (Kei Sato) @SystemsVirology
Japan - #Omicron is less infectious and pathogenic than #Delta
and even an early pandemic
SARS-CoV-2 in infected hamster model. 1/5
-----------------------------------------------
Omicron infection enhances neutralizing immunity against Delta
------------------------------------------------
> One of the studies shows omicron is 89% as severe in people
with no vax, never infected
----------------------------------------------------------------
-
Coetzee :
"And their symptoms don't seem to get any worse than that. After
about five
days they clear up, and that's it."
----------------------------------------------------------------
---------
Omicron appears to have switched cell entry preference to
endosomal fusion
(rather than ACE2+TMPRSS2 mediated cell surface fusion
like previous variants, incl. the well adapted Delta)
----------------------------------------------------------------
------
Robert Koch Institute report released today states that 95.58%
of the #Omicron cases
in Germany are fully vaccinated (28% of those had a "booster"),
4.42% are unvaccinated.
--------------------------------------------------------
the 2nd dose mRNA vaccine given to someone who also had past
infection
did not further increase antibodies
---------------------------------------------------
---------------------------------------------------------------
Daily modelled estimates produced by the ONS showed around
9.5% of Londoners had
COVID-19 as of Sunday
Report also showed a record 1 in 35 people in England had
COVID-19 between Dec.
13 and Dec. 19
The ONS report also showed a record 1 in 35 people in England
had COVID-19 between Dec. 13 and Dec. 19 — compared with a
previous estimate published on Thursday of 1 in 45 in the week
to Dec. 16.
7% infected in London during Christmas
----------------------------------------------------------------
-
Study estimates nation’s Omicron outbreak grew 70% in a week to
hit one in 25 people – as data shows infections are now rising
quickest in over-65s
The Office for National Statistics swabbing estimates that 2.03
million people had the virus
on any given day in the week before Christmas
2022-01-01 , granthshala.com
The ONS conducts weekly surveillance tests
----------------------------------------------------------------
------
2022-01-04 , Neil Ferguson warns of 5,000 Omicron deaths a DAY
in UK
ahh, seems to be old news (I had missed it)
Published: 15:38 GMT, 17 December 2021 | Updated: 23:58 GMT, 17
December 2021
----------------------------------------------------------------
-----
@IHME_UW
new projections show that daily estimated #COVID19 infections
has peaked at 6.2 million
on 1/6 in the US, but daily cases will rise to nearly 1.2
million by 1/19, 2022.
80-90% asymptomatic
---------------------------------------------------------------
intrinsically reduced virulence may account for an approx 25%
*****************************************************
DIR Next Page