URI:
   DIR Return Create A Forum - Home
       ---------------------------------------------------------
       nCoV_info
  HTML https://ncovinfo.createaforum.com
       ---------------------------------------------------------
       *****************************************************
   DIR Return to: genetics
       *****************************************************
       #Post#: 310--------------------------------------------------
       B.1.1.529 (=omicron)
       By: gsgs Date: November 25, 2021, 10:20 pm
       ---------------------------------------------------------
  HTML http://magictour.free.fr/zaf2i.GIF
  HTML http://magictour.free.fr/hospgt.GIF
       nicd-files :
  HTML https://www.nicd.ac.za/wp-content/uploads/2021/12/
       reports :
  HTML https://www.nicd.ac.za/diseases-a-z-index/disease-index-covid-19/surveillance-reports/covid-19-special-reports/
       daily hosp.:
  HTML https://www.nicd.ac.za/diseases-a-z-index/disease-index-covid-19/surveillance-reports/daily-hospital-surveillance-datcov-report/
       daily :
  HTML https://www.nicd.ac.za/latest-confirmed-cases-of-covid-19-in-south-africa-5-december-2021/
  HTML https://www.nicd.ac.za/diseases-a-z-index/disease-index-covid-19/surveillance-reports/national-covid-19-daily-report/
       dashboard :
  HTML https://gis.nicd.ac.za/portal/apps/opsdashboard/index.html#/15eb33988f104b73867606c1248578ff
  HTML https://sacoronavirus.co.za/live-counter/
  HTML https://www.timeslive.co.za/
  HTML https://rekord.co.za
  HTML https://www.citizen.co.za/
  HTML https://www.businesslive.co.za/bd/
  HTML https://www.sowetanlive.co.za/
  HTML https://www.iol.co.za/the-star
       --------------------------------------------
  HTML https://twitter.com/miamalan/status/1463846528578109444
  HTML https://twitter.com/Tuliodna
       ----------------------------------------------------------------
       -------------------------------
       weekly hospital admissions
       S.Africa,599,554,536,628,1215,1802
       Gauteng,132,127,143,303,821,1130   (1,71,201,827,1130)
       ----------------------------------------------------------------
       --------------------------------
  HTML https://www.dailymail.co.uk/news/article-10229159/South-Africa-new-red-travel-list-early-TOMORROW-fears-mutant-strain.html
       'worst-ever' super-mutant Covid variant that will make vaccines
       at least 40 per cent 'less effective'
       South Africa, Namibia, Lesotho, Botswana, Eswatini and Zimbabwe
       ; emerged in Botswana
       ------------------------------------------
       We estimate that 90% of the cases in Gauteng (at least 1000 a
       day are this variant,
       ---------------------------------------------
       A57V  ,  del 69-70 , T95I , G142D , del 143-145 , N211I , L212V
       , RE , V213P , R214E , G339D
       S371L , S373P , S375F , K417N , N440K , G445S , S477N , T478K ,
       E484K , Q493R
       G496S , Q498R , N501Y , Y505H , T547K , D614G , H655Y , N679K ,
       P681N , N784K
       D796Y , N856K , Q954H , N969K , L981F
       -------------------------------------------
       [code]
       spike:
       A67V
       del 69-70
       T95I
       G142D
       del 143-145
       N211I
       L212V_RE
       V213P
       R214E
       G339D
       S371L
       S373P
       S375F
       K417N
       N440K
       G446S
       S477N
       T478K
       E484A
       Q493R
       G496S
       Q498R
       N501Y
       Y505H
       T547K
       D614G
       H655Y
       N679K
       P681H
       N764K
       D796Y
       N856K
       Q954H
       N969K
       L981F
       E:T9I
       M:D3G
       M:Q19E
       M:A63T
       N:P13L
       N:del 31-33
       N:R203K
       N:G204R
       orf1ab :
       PL:K38R
       PL:L862LF
       PL:V1069I
       PL:del 1265
       PL:L1266I
       PL:A1892T
       nsp4:T492I
       3CL:P132H
       nsp6:F34FL
       nsp6:F35FILV
       nsp6:del 105-107
       nsp6:I189V
       RdRP:P323L
       nsp14:I42V
       nsp15:F122FILV
       [/code]
       -------------------------------------------------------
       available genomes up to 10 mutations apart.
       available genomes up to 10 mutations apart.
       “Omicron did not descend from previously identified "variant"
       viruses and instead,
       their closest evolutionary connection is to mid-2020 viruses”
       writes @trvrb
       The WHO has named it "omicron," and classified it as the worst
       variant yet,
       both in transmissibility and virulence.
       ---------------------------------------------------------
       Dr. Angelique Coetzee, chair of the South African Medical
       Association and a practising GP based in Pretoria, said it
       was "premature" to make predictions of a health crisis.
       "It's all speculation at this stage. It may be it's highly
       transmissable but so far the cases we are seeing are
       extremely mild," she said.
       "Maybe two weeks from now I will have a different opinion
       but this is what we are seeing. So are we seriously worried ?
       No. We are concerned and we watch what's happening.
       But for now we're saying "OK; there's a whole hype out there,
       [We're] not sure why."
       -------------------------------------------------
       Belgium in an unvaccinated young adult woman who developed mild
       flu-like symptoms 11 days after travelling to Egypt via Turkey.
       -----------------------------------------------
  HTML https://www.citizen.co.za/news/covid-19/2931496/new-covid-variant-more-transmissible/
       Minister of Health Dr Joe Phahlaa
       The NICD reported no unusual symptoms have been reported on
       those infected with
       the B.1.1.529 variant, and as with other variants, some people
       infected with the variant
       are asymptomatic as well.
  HTML https://www.sowetanlive.co.za/news/south-africa/2021-11-26-covid-19-hospital-admissions-rise-in-gauteng-as-new-variant-rocks-sa/
  HTML https://simple.wikipedia.org/wiki/COVID-19_pandemic_in_South_Africa
       provincial health department of Gauteng gives daily numbers
       of cases and hospitalisations
       NICD : national infectious ...
  HTML https://www.nicd.ac.za/latest-confirmed-cases-of-covid-19-in-south-africa-26-november-2021/
       -------------------------------------------------
       Nov 23
       #COVID19 UPDATE: A total of 40,791 tests were conducted in the
       last 24hrs,
       with 868 new cases, which represents a 2.1% positivity rate. A
       further 51#COVID19
       related deaths have been reported, bringing total fatalities to
       89,635 to date.
       See more here:
  HTML http://ow.ly/MZkr50GUFMc
       Nov 22  The @nicd_sa
       has observed an increase in the 7-day moving average for new
       COVID-19 cases
       and the percentage testing positive in Gauteng, particularly in
       Tshwane
       amongst 10 – 29 year old's over the past week. Read more here
       Additionally, the NICD has recently identified a cluster amongst
       the 20 – 44 age
       group at an institute of higher education in Tshwane
       --------------------------------------------------------
       cases Oct24-Nov27 :
  HTML http://magictour.free.fr/zaf2d.GIF
       --------------------------------------------------
       SA-doctor about omicron symptoms :
       intense fatigue and a six-year-old child with a very high pulse
       rate, she said.
       None suffered from a loss of taste or smell.
       mostly healthy men who turned up “feeling so tired”.
       About half of them were unvaccinated.
       her patients were all healthy and she was worried the new
       variant
       could still hit older people – with co-morbidities such as
       diabetes
       or heart disease – much harder.
       ------------------------------------------------------
       only 30 hospital admissions yesterday !
  HTML https://www.nicd.ac.za/latest-confirmed-cases-of-covid-19-in-south-africa-27-november-2021/
       almost as last week, down from 58,98,60
       ----------------------------------------------------------------
       ----------
       "We’re seeing a marked change in the demographic profile of
       patients with COVID-19,”
       Rudo Mathivha, head of the intensive care unit at Soweto’s
       Baragwanath Hospital
       Young people, in their 20s to just over their late 30s, are
       coming in with moderate
       to severe disease, some needing intensive care. About 65% are
       not vaccinated and
       most of the rest are only half-vaccinated,”
       What looked like a cluster infection among some university
       students in Pretoria
       ballooned into hundreds of new cases and then thousands, first
       in the capital city
       and then to nearby Johannesburg,
       ----------------------------------------------------------------
       --------
       said Dr. Graham Snyder, medical director ...
       Professor Andrew Pollard, the director of the Oxford Vaccine
       Group, also said existing
       vaccines should work against the new strain,
       “It’s extremely unlikely that a reboot of a pandemic in a
       vaccinated population
       like we saw last year (with the Delta variant) is going to
       happen,” he told BBC radio.
       The National Coronavirus Command Council (NCCC) met Saturday to
       discuss
       possible measures, while weighing the impact any moves will have
       on the
       economy, said the people, who asked not to be identified because
       the talks aren’t public.
  HTML https://en.wikipedia.org/wiki/List_of_newspapers_in_South_Africa
  HTML https://www.sowetanlive.co.za/
  HTML https://www.iol.co.za/the-star
  HTML https://www.timeslive.co.za/
  HTML https://www.timeslive.co.za/news/south-africa/2021-11-27-young-people-bearing-brunt-of-covid-19-resurgence-icu-doctor-warns/
  HTML https://www.citizen.co.za/
  HTML https://www.citizen.co.za/news/covid-19/2931662/astrazeneca-jab-scientist-says-vaccines-should-work-against-omicron/
  HTML https://www.businesslive.co.za/bd/
       40% of vaccinated Malaysians received Sinovac, which has much
       higher breakthrough
       infection risk than Pfizer and AZ.
       The two positive #Omicron cases were asymptomatic and fully
       vaccinated.
       They were amongst fourteen people from southern Africa who
       arrived on Qatar
       Airways flight QR908, Doha to Sydney,
       Four (4) cases of the new variant, omicron, and all were fully
       vaccinated.
       Boris Johnson says omicron can spread rapidly and affect those
       who are double vaccinated
       South Africa's health minister says on Nov26 , based on a small
       sample of Omicron cases,
       the majority of hospital patients are unvaccinated: "It
       indicates that the vaccines are
       providing protection"
       Currently there are around 1.000 confirmed/suspected Omicron
       cases.
       COVID has a hospitalization rate of around 4%, CFR of around
       0.8% in some countries.
       Drosten geht davon aus, dass Impfstoffe auch gegen omicron
       schützen.
       noch nicht sicher nachgewiesen, dass die neue Variante auch
       ansteckender ist.
       keine Hinweise darauf, dass das Virus schwerere
       Krankheitsverläufe auslösen kann
       Unterbinden von Flugverbindungen ... gerechtfertigt
       Klaus Stöhr hält Reisebeschränkungen für sinnlos und beruhigt:
       Die Impfstoffe wirkten auch gegen mutierte Coronaviren.
       --------------------------------------
       Most were men aged under 40. Just under half were vaccinated.
       They also had mild muscle aches, a “scratchy throat” and dry
       cough, she said.
       Only a few had a slightly high temperature.
       These very mild symptoms were different to other variants,
       which gave more severe symptoms.
       Coetzee alerted health officials of a “clinical picture that
       doesn’t fit Delta”
       on November 18, when she received the first seven of her 30-odd
       patients.
       -----------------------------------
       Coetzee - video :
  HTML https://www.thegatewaypundit.com/2021/11/update-south-african-doctor-discovered-omitron-variant-says-nothing-worry-mild-symptoms-video/?utm_source=Twitter&utm_medium=PostTopSharingButtons&utm_campaign=websitesharingbuttons
       Moderna  chief medical officer Paul Burton said he suspects the
       new Omicron
       coronavirus variant may elude current vaccines, and if so, a
       reformulated shot
       could be available early in 2022.
       -------------------------------------------------------
       No new Covid-19 restrictions will be imposed but the government
       has set up
       a task team to explore the possibility of mandatory vaccines,
       South African President Cyril Ramaphosa said on Sunday.
       2021-11-28
       The country will remain on coronavirus alert level 1 for now.
       [because of vaccines]
       The ministerial advisory committee has suggested booster doses
       for the older
       population and those with immunodeficiencies, on the
       recommendation of doctors.
       Ramaphosa said both a fourth wave and new variants were expected
       by scientists.
       -------------------------------------------------------
       health minister Phaahia calls for vaccinations, but no
       mentioning of evidence that
       the vaccine still works
       ------------------------------------------------------------
       Großbritannien hat wegen der sich ausbreitenden Omikron-Variante
       des Coronavirus
       ein außerplanmäßiges Treffen der G7-Gesundheitsminister
       einberufen.
       Es findert nach Angaben der Regierung in London bereits heute
       statt.
       -------------------------------------------------
       Barry Schoub, the head of South Africa’s Ministerial Advisory
       Committee of SA..
       @sailorrooscout
       “I think what we can be pretty comfortable… that the vaccine
       will still prevent serious disease,” he said. “That I think we
       are pretty sure about. How effective it will be in preventing
       milder disease —
       that we’ve still got to understand.”
  HTML https://timesofisrael.com/s-african-expe
  HTML https://www.timesofisrael.com/s-african-expert-downplays-threat-from-omicron-we-wont-have-a-severe-epidemic/
       -------------------------------------------------------
       On FTN, @ScottGottliebMD says: "If you talk to people in vaccine
       circles, people who are
       working on a vaccine, they have a pretty good degree of
       confidence that a boosted
       vaccine — so, three full doses of vaccine — is going to be
       fairly protective against
       this new variant."
       ----------------------------------------------------------------
       -
       The "vast majority" of Covid-19 patients recently admitted to
       hospital were unvaccinated,
       and most were younger adults
       ---------------------------------------------------------
       private general practitioner (GP) Dr Unben Pillay told a
       department of health virtual media
       briefing that in the past 10 days, GPs started seeing “a sharp
       increase in cases of patients
       presenting with flu-like symptoms: dry cough, fever, night sweat
       and general body pains”.
       ----------------------------------------------------------------
       ----------
       WHO also weighed in on effectiveness of earlier infection
       against Omicron, noting that
       early evidence suggests an increased risk of reinfection.
       ----------------------------------------------------------------
       ------
       the WHO said corticosteroids and IL6 receptor blockers are still
       effective for treating
       patients with severe COVID-19,
       ----------------------------------------------------------------
       ---------------------------------
       #Post#: 311--------------------------------------------------
       Re: B.1.1.529 (=omicron)
       By: gsgs Date: November 29, 2021, 10:59 pm
       ---------------------------------------------------------
       That same day, a 36-year-old man left South Africa for Hong
       Kong, a city with some of the strictest quarantine rules on
       earth. On Nov. 13, while staying in a designated quarantine
       hotel, he took a test that confirmed him as one of the earliest
       cases of Omicron.
       Five days later, a 62-year old man staying in the room across
       the corridor also tested positive. He, too, had the variant, and
       the genomes of the two samples were so close that one had
       clearly caught the virus from the other, said Yuen Kwok-yung, an
       infectious diseases professor at the University of Hong Kong who
       advises the city’s government on their pandemic response.
       CCTV monitors, however, showed that the two men had never met,
       nor opened their doors at the same time, nor shared any items,
       and had only contacted hotel personnel in full protective gear,
       said Prof. Yuen. Most likely, air from one of their hotel rooms
       spread into the hallway and through a door opening, where the
       other breathed it in, said Prof. Yuen, who inspected the site
       using a smoke test.
       #Post#: 312--------------------------------------------------
       Re: B.1.1.529 (=omicron)
       By: gsgs Date: November 30, 2021, 12:12 am
       ---------------------------------------------------------
       flutrackers-thread:
  HTML https://flutrackers.com/forum/forum/the-pandemic-discussion-forum/928700-omicron-covid-19-variant-b-1-1529-a-variant-of-concern/page2
       ----------------------------------------------------------------
       Gauteng:
       weekly hosp : 125,120,135,276,580,71(incomplete)
       weekly cases : 593,547,426,737,2762
       weekly pos.rates 0.9%,0.9%,0.7%,1.1%,4.3%
       9,8,7,3,1,1,1,1,1,0 promille increase yesterday in hosp by
       age10group
       {doesn't look milder than delta from these numbers}
       ----------------------------------------------------------------
       --------------------------
       > Israel is now reporting community transmission of Omicron
       from a cardiologist
       > with 3 doses to another cardiologist with 3 doses Warning
       sign
       --------------------------------------------------------------
       2021-11-30 : 5 omicron sequences at cog-UK
       [code]
       B.1.1.529 w=9
       ENG/MILK-2B987AD/2021,Y,2021-11-22,100,
       B.1.1.529,PLEARN-v1.2.97,0.0,0.9925692411619005,     Omicron
       (B.1.1.529-like),0.851100,0.000000,X,X,T,A,H,del,Q,L,
       orf1ab:K856R, synSNP:C3037T, synSNP:T5386G, synSNP:G5515T,
       orf1ab:A2710T, orf1ab:T3255I, orf1ab:P3395H,
       orf1ab:I3758V,synSNP:T13195C, orf1ab:P4715L,synSNP:C15240T,
       orf1ab:I5967V,        S:A67V,        S:T95I,       S:G339D,
       S:S371L,       S:S373P,       S:S375F,       S:S477N,
       S:T478K,       S:E484A,       S:Q493R,       S:G496S,
       S:Q498R,       S:N501Y,       S:Y505H,       S:T547K,
       S:D614G,       S:H655Y,       S:N679K,       S:P681H,
       S:N764K,       S:D796Y,       S:N856K,       S:Q954H,
       S:N969K,       S:L981F,synSNP:C25000T,synSNP:C25584T,
       E:T9I,         M:D3G,        M:Q19E,
       M:A63T,synSNP:A27259C,        N:P13L,       N:R203K,
       N:G204R,             Y,             G,             A,
       ref,             _
       ENG/MILK-2B95A89/2021,Y,2021-11-22,100,
       B.1.1.529,PLEARN-v1.2.97,0.0,0.9964109466128309,     Omicron
       (B.1.1.529-like),0.936200,0.000000,X,X,T,A,H,del,Q,L,
       orf1ab:K856R, synSNP:C3037T, synSNP:T5386G, orf1ab:T1822I,
       orf1ab:A2710T, orf1ab:T3255I, orf1ab:P3395H,
       orf1ab:I3758V,synSNP:T13195C, orf1ab:P4715L,synSNP:C15240T,
       orf1ab:I5967V,        S:A67V,        S:T95I,       S:G339D,
       S:S371L,       S:S373P,       S:S375F,       S:K417N,
       S:S477N,       S:T478K,       S:E484A,       S:Q493R,
       S:G496S,       S:Q498R,       S:N501Y,       S:Y505H,
       S:T547K,       S:D614G,       S:H655Y,       S:N679K,
       S:P681H,       S:N764K,       S:D796Y,       S:N856K,
       S:Q954H,       S:N969K,
       S:L981F,synSNP:C25000T,synSNP:C25584T,         E:T9I,
       M:D3G,        M:Q19E,        M:A63T,synSNP:A27259C,
       N:P13L,       N:R203K,       N:G204R,             Y,
       G,             A,           ref,             _
       ENG/ALDP-2B4DF63/2021,Y,2021-11-20, 99,
       B.1.1.529,PLEARN-v1.2.97,0.0,0.9925692411619005,     Omicron
       (B.1.1.529-like),0.851100,0.000000,X,X,T,A,H,del,Q,L,
       orf1ab:K856R, synSNP:C3037T, synSNP:T5386G, orf1ab:V1887I,
       orf1ab:A2710T, orf1ab:T3255I, orf1ab:P3395H,
       orf1ab:I3758V,synSNP:T13195C, orf1ab:P4715L,synSNP:C15240T,
       orf1ab:F5086Y, orf1ab:I5967V,        S:A67V,        S:T95I,
       S:G339D,       S:S371L,       S:S373P,       S:S375F,
       S:S477N,       S:T478K,       S:E484A,       S:Q493R,
       S:G496S,       S:Q498R,       S:N501Y,       S:Y505H,
       S:T547K,       S:D614G,       S:H655Y,       S:N679K,
       S:P681H,       S:N764K,       S:D796Y,       S:N856K,
       S:Q954H,       S:N969K,
       S:L981F,synSNP:C25000T,synSNP:C25584T,         E:T9I,
       M:D3G,        M:Q19E,        M:A63T,synSNP:A27259C,
       N:P13L,       N:R203K,       N:G204R,             Y,
       G,             A,           ref,             _
       ENG/MILK-2B67570/2021,Y,2021-11-21,100,
       B.1.1.529,PLEARN-v1.2.97,0.0,0.9925692411619005,     Omicron
       (B.1.1.529-like),0.851100,0.000000,X,X,T,A,H,del,Q,L,
       orf1ab:K856R, synSNP:C3037T, synSNP:T5386G, orf1ab:V1887I,
       orf1ab:A2710T, orf1ab:T3255I, orf1ab:P3395H,
       orf1ab:I3758V,synSNP:T13195C, orf1ab:P4715L,synSNP:C15240T,
       orf1ab:I5967V,        S:A67V,        S:T95I,       S:G339D,
       S:S371L,       S:S373P,       S:S375F,       S:S477N,
       S:T478K,       S:E484A,       S:Q493R,       S:G496S,
       S:Q498R,       S:N501Y,       S:Y505H,       S:T547K,
       S:D614G,       S:H655Y,       S:N679K,       S:P681H,
       S:N764K,       S:D796Y,       S:N856K,       S:Q954H,
       S:N969K,       S:L981F,synSNP:C25000T,synSNP:C25584T,
       E:T9I,         M:D3G,        M:Q19E,
       M:A63T,synSNP:A27259C,        N:P13L,       N:R203K,
       N:G204R,             Y,             G,             A,
       ref,             _
       ENG/PHEC-3U06FU0A/2021,N,2021-11-23,100,
       B.1.1.529,PLEARN-v1.2.97,0.0,0.9247776976688296,     Omicron
       (B.1.1.529-like),0.680900,0.000000,X,X,T,X,H,del,X,L,
       orf1ab:K856R, synSNP:C3037T, synSNP:T5386G, orf1ab:A2710T,
       orf1ab:T3255I, orf1ab:P3395H, orf1ab:I3758V,synSNP:T13195C,
       orf1ab:P4715L,synSNP:C15240T, orf1ab:I5967V,        S:A67V,
       S:T95I,       S:G339D,       S:T547K,       S:D614G,
       S:H655Y,       S:N679K,       S:P681H,       S:N764K,
       S:D796Y,       S:N856K,       S:Q954H,       S:N969K,
       S:L981F,synSNP:C25000T,synSNP:C25584T,         E:T9I,
       M:Q19E,        M:A63T,synSNP:A27259C,        N:P13L,
       N:R203K,       N:G204R,             X,             G,
       X,           ref,
       [/code]
       [code]
       1  2  3  4  5  6
       --------------------------------------------------
       1 >Wuhan-Hu1                  0 54 60 54 38 59
       2 >England/MILK-2B987AD/202  54  0  9  4  3 10
       3 >England/MILK-2B95A89/202  60  9  0  9  8  5
       4 >England/MILK-2B67570/202  54  4  9  0  3  6
       5 >England/PHEC-3U06FU0A/202 38  3  8  3  0  8
       6 >England/ALDP-2B4DF63/202  59 10  5  6  8  0
       ---------------------------------------------------
       1  2  3  4  5  6
       
       0000000000111111111111112222222222222222222222222222222222222222
       
       0233555588001344558999991122222233333333333333344445566667788888
       
       2808357938045145251222227856666800000000245668914450525572823888
       
       4337813293243905426011116488889200245678113016533710973816182999
       
       1277650435997582013902472672385214297424124833793829399688600012
       -codon-position---------- 1111 22   2122 21 1 22   2 2 1    2 22
       21 1211121 21  1 2  12
       Index--------------------CACTTGCGGTCCATCTCTATAAACCCGTCTCGGCAAGAA
       TCACTCCGCATCCCCACGACACGGG
       1 >Wuhan-Hu1
       ................................................................
       2 >ENG/MILK-2B987AD/202
       TGTKGT..A.TAGCT.TWG.....TTACTCT-AACGAGTCAGTGAATATATTTTGGACTTTAAC
       4 >ENG/MILK-2B67570/202
       TGT.G..AAYTAGCT.TWG.....TTACTCT-AACGAGTCAGTGAATATATTTTGGACTTTAAC
       5 >ENG/PHEC-3U06FU0A/202
       TGT.G...A.TAGCT.T.G.....TTA-------------AGTGAATATATTTT-GACTTTAAC
       3 >ENG/MILK-2B95A89/202
       TGT.G.T.A.TAGCTYTWGKRRRMTTACTCTTAACGAGTCAGTGAATATATTTTGGACTTTAAC
       6 >ENG/ALDP-2B4DF63/202
       TGT.G..AAYTAGCT.TAGKRRRMTTACTCT-AACGAGTCAGTGAATATATTTTGGACTTTAAC
       Index--------------------CACTTGCGGTCCATCTCTATAAACCCGTCTCGGCAAGAA
       TCACTCCGCATCCCCACGACACGGG
       -codon-position----------1 1111 22   2122 21 1 22   2 2 1    2
       22  21 1211121 21  1 2  12
       
       0000000000111111111111112222222222222222222222222222222222222222
       
       0233555588001344558999991122222233333333333333344445566667788888
       
       2808357938045145251222227856666800000000245668914450525572823888
       
       4337813293243905426011116488889200245678113016533710973816182999
       
       1277650435997582013902472672385214297424124833793829399688600012
       [/code]
       @TWenseleers
       But to explain the current growth rate advantage of Omicron over
       Delta one already
       has to assume almost complete immune evasion even if one assumes
       an R0 that is
       the same as Delta. R0 can't be much less than that of Delta then
       I would say...
       ---------------------------------------------------------------
       cluster at TUT Nov.18
  HTML https://rekord.co.za/399202/concerns-over-rising-covid-19-cases-in-tshwane/
       ----------------------------------------------------------------
       ---
       Head of EU Public Health gives information that thus far
       *ALL* (42) Omicron cases in EU are either mild or without
       symptoms.
       ----------------------------------------------------------------
       On Monday, an NICD presentation a flagged a large number of
       COVID-19
       admissions among infants aged under two years as an area of
       concern.
       But von Gottberg cautioned against linking that with Omicron
       just yet.
       "It looks like in fact some of those admissions might have
       started before
       the emergence of Omicron. We are also seeing that there was an
       increase
       in influenza cases just in the last month or so, and so we need
       to be really
       careful to look at the other respiratory infections," she said.
       ----------------------------------------------------
       ... a report by Channel 12 said the Pfizer vaccine is just
       slightly less effective in
       preventing infection with Omicron than with Delta – 90% as
       opposed to 95% –
       while it is as effective – around 93% – in preventing serious
       symptoms at least
       for those vaccinated with a booster.
       According to the report, the ability of the variant to infect is
       higher than Delta but
       not as much as feared – around 1.3 times higher...
       ----------------------------------------------------------------
       -
       Minimum dose interval for booster jabs to be halved from 6
       months to 3
       months and all adults to be offered booster Covid vaccine,
       UK  Health Secretary  Sajid Javid confirms
       -----------------------------------------------------
       @jburnmurdoch
       So far admissions following ~same path as past waves.
       ------------------------------------------------------------
       The earliest known cases are still from southern Africa. The
       first identified samples were
       collected Nov. 9, from a 34-year-old man and a 23-year-old man
       in Johannesburg,
       according to the GISAID global database. On Nov. 11, five
       samples of the variant were
       collected in Botswana.
       -----------------------------------------------------------
       #Post#: 313--------------------------------------------------
       Re: B.1.1.529 (=omicron)
       By: gsgs Date: December 1, 2021, 4:48 am
       ---------------------------------------------------------
       2021-12-01
       ----------------------------------------------------------------
       -------
       Botswana :  15 more cases (+4=19)
       14 in the Greater Gaborone DHMT area,
       4 in the Serowe/Palapye DHMT area, Truck drivers
       1 in Kgatleng DHMT   from ZA
       3 mild , 12 none  11 vaxed 4 not (asym)
       ----------------------------------------------------------------
       ----
       map of the initial omicron-wave in ZA :
  HTML http://magictour.free.fr/o-1201.GIF
       ----------------------------------------------------------------
       --------------
       On Omicron, for people with prior Covid but unvaccinated:
       “In our population…where many people have had previous
       infection,
       we believe that that previous infection doesn’t provide them
       with
       protection from infection due to Omicron”
       ----------------------------------------------------------------
       --
  HTML https://www.centerforhealthsecurity.org/our-work/publications/to-stop-a-pandemic--a-better-approach-to-global-health-security
       To Stop a Pandemic - A Better Approach to Global Health Security
       cited by 5 :
  HTML https://scholar.google.de/scholar?cites=12966832627588286534&as_sdt=2005&sciodt=0,5&hl=de
       ----------------------------------------------------------------
       -------
       what was that organisation, created last year, dedicated to find
       and stop new outbreaks like omicron ?
       Head was Ian Lipkin, I remember how I applauded at twitter. But
       now I can't find it.
       Only nichtssagende stetments by Lipkin now, no reference to that
       task.
       We were asking for it here since 2006's H5N1
       China stopped Wuhan-Hu-1 in Feb.2020
       But they let it escape to other countries
       and most of the rest of the world didn't stop it
       Alpha, Delta were detected too late.
       Omicron was detected early but spreads better and faster, but i
       think we should try to stop it to contain it now.,
       support ZA's measures financially. Although it's probably invain
       and too late.
  HTML https://www.chinadaily.com.cn/a/202103/10/WS604819fda31024ad0baae175.html
       The key to global public health is global cooperation,
       transparency and investment."
       the lack of international, inter-institutional and interpersonal
       trust, respect and collaboration,
       [not the project that I had in mind. It was rather about early
       stopping emerging pandemics]
       ----------------------------------------------------------------
       --------
  HTML https://twitter.com/PPI_Insights
       ----------------------------------------------------------------
       ----------
       Epidemiological data from South Africa shows a 3-fold increase
       in risk for reinfection
       due to Omicron vs. Beta and Delta.
       ----------------------------------------------------------------
       --------
       Eine Überstandene Corona-Infektion schützt laut WHO offenbar
       nicht vor Omikron-Variante
       SUBSTANTIAL population-level evidence for evasion of immunity
       from prior infection
  HTML https://www.medrxiv.org/content/10.1101/2021.11.11.21266068v2
       ----------------------------------------------------------------
       --
       67 omicrons at cog-uk on 1202
       ---------------------------------------------------------
       #Post#: 314--------------------------------------------------
       Re: B.1.1.529 (=omicron)
       By: gsgs Date: December 3, 2021, 10:40 pm
       ---------------------------------------------------------
       2021-12-04
       BioNTech-Chef sieht Notwendigkeit Impfstoff-Anpassung
       -------------------------------------
       Risk Assessment for Omicron has been published.
       Everything is still uncertain, but it doesn't look good.
  HTML https://twitter.com/Dr_D_Robertson/status/1466807346487869445/photo/1
       ---------------------------------------
       first time we've seen data on vaccination status of hospitalised
       covid patients in Gauteng
       vaccination status of in-hospital patients (n=1351) public and
       private
       total:1121+230
       unknown : 814 ; 190
       no : 286 ; 31
       yes : 21 ; 9
       general wards  ; ICU/HC
       VE(hosp)=86% , VE(ICU)=46%(low numbers)
       ----------------------------------------------------------------
       ----
       In France the numbers have been inverting for a few months now
       (then again,
       it's winter now over here)
       Some regions show up to 76% vaccinated in ICU, despite 94%
       vaccination status (12+yo)
       ----------------------------------------------------------------
       ---
       What the CDC in Europe reported today is 50% of the cases
       they've seen outside
       South Africa have been asymptomatic, 50% have just presented
       with mild symptoms,"
       says @ScottGottliebMD on Omicron. "The vaccines--seem to be
       protective against more severe disease."
       ---------------------------------------------------------------
  HTML https://twitter.com/jburnmurdoch/status/1467270450111787012
       ------------------------------------------------------
       2021-12-06, 183 confirmed omicron-cases in Denmark
       -----------------------------------------------------
       J.Ward estimates the impact of omicron :
  HTML https://twitter.com/JamesWard73/status/1467631048267866117
       --------------------------------------------------------
       Data from @nicd_sa
       show that in Gauteng province, the share of Covid-positive
       patients in ICU or on
       ventilators is somewhere between 2-3x lower than it was at the
       same stage of
       the Delta wave
       ------------------------------------------------------
       In southern New England, it turns out that ~27% of vaccines
       were given to
       previously infected individuals. Pre-print below. 1/
  HTML https://medrxiv.org/content/10.110
       #Post#: 315--------------------------------------------------
       Re: B.1.1.529 (=omicron)
       By: gsgs Date: December 7, 2021, 10:48 pm
       ---------------------------------------------------------
  HTML https://drive.google.com/file/d/1bBO3DLrvVMYYMDg5CKUBVaunyKvOVfhv/view
       Alex Sigal    @sigallab   7h
       There are a few results:
       1. Omicron still uses ACE2
       2. There is a very large drop in neutralization of Omicron by
       BNT162b2 (2 doses) immunity
       relative to ancestral virus
       3. Omicron escape from BNT162b2 neutralization is incomplete.
       Previous infection + vaccination still neutralizes
       ------------------------------------
       this was better than I expected of Omicron.
       -----------------------------
       Chise
       Reduction in nAbs was even LESS in those who had a previous
       infection & two
       doses of Pfizer’s vaccine. Boosters should be able to take this
       on!
       ------------------------------------
       right thing to do to switch vaccine between prime and boost
       =====================================
       @BenjMurrell
  HTML https://drive.google.com/file/d/1CuxmNYj5cpIuxWXhjjVmuDqntxXwlfXQ/view
       Omicron antibody neutralization thread, with preliminary
       results, and substantial caveats.
       our first results were read this afternoon (1/n).
       =====================================================
       @CiesekSandra  2021-12-08,06:20UTC
       2x Biontech, 2x Moderna, 1xAZ/1x Biontech  nach 6 Monaten 0%
       Neutralisation bei Omicron,
       auch 3x Biontech 3 Monate nach Booster nur 25% NT versus 95% bei
       Delta.
       Bis zu 37fache Reduktion Delta vs. Omicron
  HTML https://twitter.com/CiesekSandra/status/1468465347519041539/photo/1
       Die monoklonalen AK imdevimab und casirivimab sind - wie
       erwartet- bei Omicron wirkungslos
       #Post#: 316--------------------------------------------------
       Re: B.1.1.529 (=omicron)
       By: gsgs Date: December 8, 2021, 9:21 pm
       ---------------------------------------------------------
  HTML https://www.capetalk.co.za/articles/434212/2-weeks-of-omicron-it-looks-like-people-don-t-get-as-sick-as-with-delta
       3/4 of Covid patients were in the hospital for other conditions,
       and only found out they
       had Covid-19 upon arrival.
       Hospital stays seem considerably shorter (2.8 days, on average)
       than during
       the pre-Omicron pandemic (8.5 days, on average).
       ----------------------------------------------------------------
       --
  HTML https://www.citizen.co.za/news/vaccine-info/2937972/majority-of-tshwane-patients-unvaccinated/
       24/38 adults in the Covid wards on 2 December, 24 were
       unvaccinated,
       eight had unknown vaccination status and only six had had the
       jabs.
       8/9 of hospitalised for Covid pneumonia,  were unvaccinated
       80% of admissions were below the age of 50.
       ----------------------------------------------------------------
       -----
       @K_G_Andersen
       I think it's likely VE against hospitalization will be
       relatively well-preserved (~50%?)
       with 2x vax, increasing to >75% with boost.
       I don't expect much VE to be preserved against infection.
       ----------------------------------------------------------------
       --------------
       sister lineage , BA.1 , BA.2
  HTML https://github.com/cov-lineages/pango-designation/issues/361
  HTML https://user-images.githubusercontent.com/686405/145027666-318a51b4-0053-4150-a2fc-783752442ae3.png
       #Post#: 317--------------------------------------------------
       Re: B.1.1.529 (=omicron)
       By: gsgs Date: December 9, 2021, 9:23 pm
       ---------------------------------------------------------
       "in the South African city of Tshwane, 70% of those aged 50-69
       and 90% of over-80s
       had severe cases during the Delta wave. This share is now around
       30% for all ages."
       ----------------------------------------------------------------
       ------
       2021-12-09 , Alarm as almost 20% of South Africa’s healthcare
       workers contract Covid
       Richard Lessels,
       Victor Khanyile, the deputy director of human resources at the
       department of health,
       said there were 72 678 public sector healthcare workers
       infected as of 6 December,
       representing 18% of the entire public healthcare workforce —
       403 443 clinical and support staff.
       Gauteng, at 17 008, has the highest number of healthcare
       workers infected followed by
       the Eastern Cape with 11 975 and KwaZulu-Natal with
       11 246.
       shorter-lived than previous variants
  HTML https://mg.co.za/coronavirus-essentials/2021-12-09-alarm-as-almost-20-of-south-africas-healthcare-workers-contract-covid/
       ----------------------------------------------------------------
       ----
       update week 48 , comparing hospital surveillance in Tshwane
       waves 2,3,4
  HTML https://www.nicd.ac.za/wp-content/uploads/2021/12/COVID-19-HOSPITAL-SURVEILLANCE-UPDATE_WEEK-48-2021_rev.pdf
  HTML http://magictour.free.fr/tshh48.GIF
       ----------------------------------------------------------------
       -
       Selbst Booster scheinen keinen Schutz (oder nur geringen) vor
       Infektion und leichtem Verlauf zu bieten.
       43% with dyspnaea (shortness of breath) despite 3 shots
       --------------------------------------------------------
       18/1280=1.4% of Omicron cases in Denmark are hospitalized. Delta
       was 2%
       -------------------------------------------------------
       2021-12-11 : 30% of (COVID)-infections in London are omicron
       ----------------------------------------------------
       VE(symp,2AZ,omicron,5m?,UK)=0
       VE(symp,2BNT,omicron,5m?,UK)~30%
       VE(symp,3BNT,omicron,1m,UK)=72%
  HTML https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/1040076/Technical_Briefing_31.pdf
  HTML https://twitter.com/kallmemeg/status/1469351833416122369
       -----------------------------------------------------------
  HTML https://twitter.com/BallouxFrancois/status/1469733674426023936
       also thread by Tom Moultre
       -------------------------------------------------------
       backlog now, the decrease was not real
       ----------------------------------------------------------------
       ------------
       Current earliest detection of omicron in South Africa: 8
       November, Gauteng
       ----------------------------------------------------------------
       --------------
       South African president tests positive for Covid-19
       ----------------------------------------------------------------
       --
  HTML https://www.dailymail.co.uk/news/article-10299773/South-Africas-Omicron-outbreak-slows-figures-suggest.html
       ----------------------------------------------------------------
       ----
       VE(2xBNT,omicron,hosp)=70%
       VE(2xBNT,omicron,inf)=33%
       wanes
       1. 2-4 wks after 2nd dose: 56%
       2. 3-4 mnths after 2nd dose: 25%
       VE(delta-->omicron,inf)=60%
       Adults (18+) infected with #Omicron  = 29% less likely to be
       hospitalised (than with Wuhuan-Hu1)
  HTML https://twitter.com/miamalan/status/1470684351151157252
       ----------------------------------------------------------------
       --
       VE(3*BNT,omicron,symp)=75%
       ----------------------------------------------------------------
       -
       CDC; Omicron = 2.9% of cases in USA in week 49 , CDC; 13% in
       NY,NJ
       ----------------------------------------------------------------
       ---
       SinoVac doesn’t provide sufficient antibodies to neutralize
       omicron
       ----------------------------------------------------------------
       -------
       HKUMed shows Omicron infects and multiplies 70X faster than
       Delta in the
       human bronchus, which may explain why it transmits faster, BUT
       also shows
       Omicron infection in the lung is significantly LOWER than the
       original virus,
       which may be an indicator of lower disease severity.
       ----------------------------------------------------------------
       -
       #Post#: 318--------------------------------------------------
       Re: B.1.1.529 (=omicron)
       By: gsgs Date: December 18, 2021, 11:23 pm
       ---------------------------------------------------------
       ==============================
       SA , netcare-CEO , 12-13 : it's mild
       ------------------------------------------
       neue Studie Imperial College, von Lauterbach vor 14h zitiert ,
       als wahrscheinlich eingestuft
       "Omnikron tellt alles in den Schatten, was wir bisher in
       Pandemie gesehen haben"
       Katastrophenfall in London ausgerufen
       hard lockdown in Netherlands at 2021-12-19, 5 AM
       Denmark hospitalisations remain low
       Lauterbach schliesst Lockdown ueber Weihnachten aus
       Bund und Länder beraten am Dienstag (2021-12-21) über omicron
       2021-12-20 , Ireland strengthens lockdown
       Denmark re-introduces restrictions
       Sachsen verschaeft Corona Massnahmen
       ----------------------------
       in Thueringen ab 2021-12-20
       Sobald eine ungeimpfte Person an einem Treffen teilnimmt,
       dürfen nur noch zwei Personen aus einem weiteren Haushalt dabei
       sein.
       Bisher galt diese Regel nicht für Geimpfte und Genesene.
       --------------------------------
       Der neue Expertenrat der Bundesregierung spricht sich für
       Kontaktbeschränkungen "bereits für
       die kommenden Tage" aus. Es gehe um "wirksame bundesweit
       abgestimmte Gegenmaßnahmen",
       heißt es in der Stellungnahme, die dem ARD-Hauptstadtstudio
       vorliegt
       Einschätzung der Wissenschaftler
       Bisher sei nicht davon auszugehen, dass im Vergleich zur
       Delta-Variante Menschen
       ohne Immunschutz einen milderen Krankheitsverlauf hätten
       -------------------------------
       It is obvious we are far from 95 per cent effectiveness that we
       obtained against the initial virus,"
       Ugur Sahin told on 2021-12-20
       VE(omicron,2BNT,hosp)=70%
       -----------------------------------------------
       Zoe :    Runny nose,  Headache , Fatigue , Sneezing ,   Sore
       throat
       ----------------------------------------------------------------
       --
       HALF of patients in London hospitals 'with Covid' were only
       diagnosed AFTER arriving
  HTML with another ailment https://trib.
       ----------------------------------------------------------------
       -------------
  HTML https://metro.co.uk/2021/12/16/omicron-may-be-milder-but-we-should-all-listen-to-chris-whitty-15782431/
       Chris Whitty : "slightly milder than delta"
       Omicron may be ‘intrinsically milder’,  but there is still not
       yet ‘clear evidence’.
       --------------------------------------------
  HTML https://datakingz.com/2021/12/22/london-playbook-scoop-omicron-milder-in-uk-new-years-fireworks-liz-vs-no-10/
       SCOOP: The Omicron coronavirus variant is causing a milder
       disease than the Delta
       strain in most Britons, U.K. government scientists are set to
       conclude. The U.K.
       Health Security Agency is due to publish its early real-world
       data on the severity
       of the disease before Christmas, and Playbook is told the
       experts are likely to offer
       a mixed outlook, with some positives and some negatives
       ---------------------------------------------
       risk of hospitalisation from omicron is 1/3 of the delta risk
  HTML https://www.research.ed.ac.uk/en/pub...effectiveness-
       -------------------------------------------
       new data from @IHME_UW predict nearly 3 billion COVID-19
       infections globally
       in the next 2 months
       ----------------------------------------
       #Post#: 319--------------------------------------------------
       Re: B.1.1.529 (=omicron)
       By: gsgs Date: December 23, 2021, 5:35 am
       ---------------------------------------------------------
       early omicron severety studies :
       ZAF :
  HTML https://t.co/g24KTGU7Io
       DNK :
  HTML https://t.co/pQnetTf7IP
       ENG :
  HTML https://t.co/chqPEhph3p
       SCO :
  HTML https://t.co/CMv2zkG2sh
       DNK,VE :
  HTML https://www.medrxiv.org/content/10.1101/2021.12.20.21267966v2.full.pdf
       ----------------------------------------------------------------
       ---------
       vaccine effectiveness
       AZ,BNT,Mod
       D,2,h,78,91
       D,3,h,98,98
       O,2,h,51,75
       O,3,h,90,86
       O,2,h,ar,54,77
       O,3,h,ar,92,88
       O,2,s,--,55,37
       ar:adjusted for reinfections
       s: symptomatic disease
       h:hospitalisation
       O:omicron
       D:delta
       w:weeks
  HTML https://twitter.com/freja_kirsebom/status/1474070653326270473
       O,2AZ+BNT,s,3w,60
       O,2AZ+BNT,s,10w,35
       O,2AZ+Mod,s,10w,45
       O,3BNT,s,1w,70
       O,3BNT,s,10w,45
       O,2BNT+Mod,9w,72
       O,2Mod,3w,50
       O,2Mod,22w,0
       ----------------------------------------------------------------
       ---------
       =============================================
       SARS CoV-2 entry into a cell can occur via two routes: one that
       only needs ACE2 and
       another that needs ACE2 and TMPRSS2.
       TMPRSS2 (T2) is higher in the lower airways and so virus goes
       the second route in those areas.
       Omicron spike has reduced ability to use the ACE2+T2 route and
       doesn't respond to higher
       T2 levels, unlike Delta
       ==========================================================
       TB33 : risk(EC or hosp,omicron)=0.62*risk(EC,delta)
       risk(hosp,omicron)=0.38*risk(hosp,delta)
       This effect is still present when stratified by vaccination
       status
       Using a very similar data set, Imperial College, provided
       estimates that Omicron cases had a 15
       to 25% (Hazard ratio 0.8; 95% CI 0.75-85) reduced risk of
       emergency department attendance
       (hospitalisations in their data set) and 40 to 49% (HR 0.55, 95%
       CI 0.51-59) reduced risk of a
       hospitalisation with a stay of one or more nights. Importantly,
       this group attempt to impute the
       effect of prior infection, highlighting that while 17% of the
       population have tested positive for
       COVID-19, this is likely to capture only one-third of total
       infections that have occurred in
       England. Including the likelihood of previous infection, in
       addition to vaccination in their model,
       they have estimated the intrinsic risk difference between Delta
       and Omicron as between 0 to
       30% and the reduced risk of hospitalisation in those previously
       infected estimated as 55 to 70%.
       ===========================================================
       The Sato Lab (Kei Sato)  @SystemsVirology
       Japan - #Omicron is less infectious and pathogenic than #Delta
       and even an early pandemic
       SARS-CoV-2 in infected hamster model. 1/5
       -----------------------------------------------
       Omicron infection enhances neutralizing immunity against Delta
       ------------------------------------------------
       > One of the studies shows omicron is 89% as severe in people
       with no vax, never infected
       ----------------------------------------------------------------
       -
       Coetzee :
       "And their symptoms don't seem to get any worse than that. After
       about five
       days they clear up, and that's it."
       ----------------------------------------------------------------
       ---------
       Omicron appears to have switched cell entry preference to
       endosomal fusion
       (rather than ACE2+TMPRSS2 mediated cell surface fusion
       like previous variants, incl. the well adapted Delta)
       ----------------------------------------------------------------
       ------
       Robert Koch Institute report released today states that 95.58%
       of the #Omicron cases
       in Germany are fully vaccinated (28% of those had a "booster"),
       4.42% are unvaccinated.
       --------------------------------------------------------
       the 2nd dose mRNA vaccine given to someone who also had past
       infection
       did not further increase antibodies
       ---------------------------------------------------
       ---------------------------------------------------------------
       Daily modelled estimates produced by the ONS showed around
       9.5% of Londoners had
       COVID-19 as of Sunday
       Report also showed a record 1 in 35 people in England had
       COVID-19 between Dec.
       13 and Dec. 19
       The ONS report also showed a record 1 in 35 people in England
       had COVID-19 between Dec. 13 and Dec. 19 — compared with a
       previous estimate published on Thursday of 1 in 45 in the week
       to Dec. 16.
       7% infected in London during Christmas
       ----------------------------------------------------------------
       -
       Study estimates nation’s Omicron outbreak grew 70% in a week to
       hit one in 25 people – as data shows infections are now rising
       quickest in over-65s
       The Office for National Statistics swabbing estimates that 2.03
       million people had the virus
       on any given day in the week before Christmas
       2022-01-01 , granthshala.com
       The ONS conducts weekly surveillance tests
       ----------------------------------------------------------------
       ------
       2022-01-04 , Neil Ferguson warns of 5,000 Omicron deaths a DAY
       in UK
       ahh, seems to be old news (I had missed it)
       Published: 15:38 GMT, 17 December 2021 | Updated: 23:58 GMT, 17
       December 2021
       ----------------------------------------------------------------
       -----
       @IHME_UW
       new projections show that daily estimated #COVID19 infections
       has peaked at 6.2 million
       on 1/6 in the US, but daily cases will rise to nearly 1.2
       million by 1/19, 2022.
       80-90% asymptomatic
       ---------------------------------------------------------------
       intrinsically reduced virulence may account for an approx 25%
       *****************************************************
   DIR Next Page